Sequence ID | >W141005538 |
Genome ID | AGDV01000004 |
Search identical group | |
Phylum/Class | Spirochaetota |
Species | Treponema denticola H-22 [AGDV] |
Start position on genome | 33995 |
End posion on genome | 33922 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
gctgtcgtta |
tRNA gene sequence |
CGGGCAATAGCGCAGTTGGTTAGCGTACAAGTCTGGGGGACTTGGGGTCCCCGGTTCAAA |
Downstream region at tRNA end position |
aaacttcgtt |
Secondary structure (Cloverleaf model) | >W141005538 Pro GGG a Ataa aaacttcgtt C - G G - C G - C G - C C - G A - T A - T T A T G G G C C A T G A A | | | | | A T C G C G C C C G G C G | | | + T T G G C G T T T A A GGGTC C - G A - T A - T G - C T - A C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |