| Sequence ID | >WENV180081201 |
| Genome ID | MPMC02094647 |
| Phylum/Class | [MPMC] marine metagenome; 100 m water sample filtered on 30 um supor filter |
| Species | |
| Start position on genome | 1432 |
| End posion on genome | 1357 |
| Amino Acid | Phe |
| Anticodon | GAA |
| Upstream region at tRNA start position |
cgcggtgtgg |
| tRNA gene sequence |
GCCCAAGTAGCTCAGTTGGTAGAGCATGCGACTGAAAATCGCAGTGTCGGTGGTTCGATC |
| Downstream region at tRNA end position |
ttttttccta |
| Secondary structure (Cloverleaf model) | >WENV180081201 Phe GAA
g ACCA ttttttccta
G - C
C - G
C - G
C - G
A - T
A - T
G - C C T
T C C G C C A
T G A A | | + | | G
T C T C G G G T G G C
G | | | | T T
G G A G C
T A A GTGTC
T - A
G - C
C - G
G - C
A - T
C A
T A
G A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |