Sequence ID | >WENV180089129 |
Genome ID | MPMF02066461 |
Search identical group | |
Phylum/Class | [MPMF] marine metagenome; 120 m water sample prefiltered with 30 um filter, filtered on to 0.2 um supor filter |
Species | |
Start position on genome | 52 |
End posion on genome | 127 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
ggctcaggcc |
tRNA gene sequence |
GTCCCCTTCGTCTAGAGGCCTAGGACACCGGCCTCTCACGCCGGCAACAGGGGTTCGAAT |
Downstream region at tRNA end position |
atcttttcag |
Secondary structure (Cloverleaf model) | >WENV180089129 Glu CTC c GCCA atcttttcag G - C T - A C - G C - G C - G C - G T - A T A T T C C C C A A G A C | | | | | G G T C T G A G G G G C G + | | | T T C G G A C C T A A CAAC C - G C - G G - C G - C C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |