Sequence ID | >WENV180094334 |
Genome ID | MTBK01002698 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 457 |
End posion on genome | 544 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gaaactttaa |
tRNA gene sequence |
GCCGAGGTCGCATAGCTAGGATTAGTGCGCCGGACTTGAGATCCGGTTTCCCCTAGGGAA |
Downstream region at tRNA end position |
tctgtttttt |
Secondary structure (Cloverleaf model) | >WENV180094334 Ser TGA a GCtt tctgtttttt G - C C - G C - G G - C A - T G - C G - C T A T C C C T C A T C G A C | | | | | A A T A C G G G G A G C G + | | | T T G G T G C A T T A G TTTCCCCTAGGGAAGC C - G C - G G - C G - C A - T C A T G T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |