Sequence ID | >WENV180094463 |
Genome ID | MTBK01008393 |
Search identical group | |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 367 |
End posion on genome | 439 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
ccacctatca |
tRNA gene sequence |
GCCCAAGTAGCTCAGTTGGGAGAGCGTCAGACTGAAGATCTGAATGTCCCCGGTTCGAGT |
Downstream region at tRNA end position |
aaaattctta |
Secondary structure (Cloverleaf model) | >WENV180094463 Phe GAA a Atat aaaattctta G - C C - G C - G C - G A - T A - T G + T T G T G G G C C A T G A A | | | | | G T C T C G C C C G G C G | | | | T T G G A G C G A G ATGTC T - A C - G A - T G - C A - T C A T G G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |