Sequence ID | >WENV180094865 |
Genome ID | MTBK01035668 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 26052 |
End posion on genome | 25979 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gcgcaagcaa |
tRNA gene sequence |
GCGGGCGTAGCTCAATGGTAGAGCCCTAGTCTTCCAAACTAGCTACGCGGGTTCGATTCC |
Downstream region at tRNA end position |
caccccggcc |
Secondary structure (Cloverleaf model) | >WENV180094865 Gly TCC a TCCA caccccggcc G - C C - G G - C G - C G - C C - G G - C T T T T G C C C A A A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T A C CTAC C - G T - A A - T G - C T - A C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |