Sequence ID | >WENV180095066 |
Genome ID | MTBK01046684 |
Search identical group | |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 172 |
End posion on genome | 99 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gaatcttcat |
tRNA gene sequence |
GCCGCCATAGCTCAGTAGGTAGAGCGCTCGACTGTTAATCGAATGGTCGCAGGTTCGAGT |
Downstream region at tRNA end position |
ttgggcccgt |
Secondary structure (Cloverleaf model) | >WENV180095066 Asn GTT t GCtt ttgggcccgt G - C C - G C - G G - C C - G C - G A - T T G T C G T C C A T G A A | | | | | G A C T C G G C A G G C G | | | | T T G G A G C T A G TGGTC C A T - A C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |