Sequence ID | >WENV180095121 |
Genome ID | MTBK01050083 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 52 |
End posion on genome | 137 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atgtataggT |
tRNA gene sequence |
GCCGAGATAGTCTAGTCCGGGAAGGCGGTGGTCTTGAAAACCACTGGTGGTAACACCTCG |
Downstream region at tRNA end position |
aaatcatttt |
Secondary structure (Cloverleaf model) | >WENV180095121 Ser TGA T GTaa aaatcatttt G - C C - G C - G G - C A - T G + T A - T T A T C C C T C A T G A A | | | | | A C T C T G G G G A G C C | | + | T T G A G G C G G A G TGGTGGTAACACCTC G - C T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |