Sequence ID | >WENV180095610 |
Genome ID | MTBK01077880 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 722 |
End posion on genome | 807 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
cggcgtaccg |
tRNA gene sequence |
GGAGGGTTGTCCGAGCGGCCGATGGACCTGGTCTTGAAAACCAGTGGGCAGCAATGTCCC |
Downstream region at tRNA end position |
ccaccgtcgc |
Secondary structure (Cloverleaf model) | >WENV180095610 Ser TGA g GCtc ccaccgtcgc G - C G - C A - T G - C G - C G - C T - A T A T C A C C C A C G A G | | | | | G G G C C T G T G G G C G + | | | T T C T G G A C G A C TGGGCAGCAATGTCCC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |