Sequence ID | >WENV180095898 |
Genome ID | MTBK01096710 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 46515 |
End posion on genome | 46586 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
atgggtaggg |
tRNA gene sequence |
GGACCCATGGGGTAGAGGAGATCCTTTTGGGCTTCGAACCCAAGGACGCGGGTTCAATTC |
Downstream region at tRNA end position |
gttctacagg |
Secondary structure (Cloverleaf model) | >WENV180095898 Arg TCG g Gtca gttctacagg G - C G - C A - T C - G C - G C - G A - T T T T C G C C C A A G A G | | | | | A G T G G G G C G G G C G | | + T T A T C C T G A T GGAC T - A T - A G - C G - C G - C C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |