Sequence ID | >WENV180095993 |
Genome ID | MTBK01101183 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 4476 |
End posion on genome | 4547 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
ccttcctaat |
tRNA gene sequence |
GCCAAGGTGGCGGAGCGGCTACGCAAATGCCTGCAGAGCATTACCACTCCGGTTCGAATC |
Downstream region at tRNA end position |
cgttttcaag |
Secondary structure (Cloverleaf model) | >WENV180095993 Cys GCA t Ttct cgttttcaag G - C C - G C - G A - T A - T G - C G - C T A T A G G C C A G A G | | | | | G C G G C G T C C G G C G | | | T T G A C G C C T A ACCAC A - T A - T T - A G - C C - G C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |