Sequence ID | >WENV180096750 |
Genome ID | MTBK01144980 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 329 |
End posion on genome | 244 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gagggtcaga |
tRNA gene sequence |
GTCGAGGTCGCCTAGCTTGGTATGGCGCAGGTTTGCTAAACCTGTTCCGCTCCGCGGATC |
Downstream region at tRNA end position |
ttttaccagt |
Secondary structure (Cloverleaf model) | >WENV180096750 Ser GCT a GCta ttttaccagt G - C T + G C - G G - C A - T G - C G - C T A T C A C C C A C G A C | | | | | G T T C C G G T G G G C T | | | T T G T G G C G T A G TTCCGCTCCGCGGATC C - G A - T G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |