Sequence ID | >WENV180097635 |
Genome ID | MTBK01200828 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 656 |
End posion on genome | 742 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
gcgccgaccc |
tRNA gene sequence |
GCGCGGGTGGCGAAATTGGTAGACGCACCAGGTTTAGGTCCTGACGCCTTCACCGGCGTG |
Downstream region at tRNA end position |
tccccggccc |
Secondary structure (Cloverleaf model) | >WENV180097635 Leu TAG c ACCA tccccggccc G - C C - G G - C C - G G - C G - C G - C T G T C G G C C A T A A G | | | | | G T A G C G G C C G G C G | | | T T G A C G C T A G A CGCCTTCACCGGCGT C A C - G A - T G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |