Sequence ID | >WENV180097916 |
Genome ID | MTBK01218449 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 626 |
End posion on genome | 711 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
atagaagcga |
tRNA gene sequence |
GCCGGGATAGTCTAGTCCGGTAAGGCGGTGGCCTTGAAAGCCACTGGTGCCTGGCACCTC |
Downstream region at tRNA end position |
catcttctgt |
Secondary structure (Cloverleaf model) | >WENV180097916 Ser TGA a GCta catcttctgt G - C C - G C - G G - C G - C G - C A - T T A T C C C T C A T G A A | | | | | A C T C T G G G G A G C C | | + | T T G A G G C G T A G TGGTGCCTGGCACCTC G - C T - A G - C G - C C - G C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |