Sequence ID | >WENV180098424 |
Genome ID | MTBK01244490 |
Search identical group | |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 535 |
End posion on genome | 459 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
tgctaatttt |
tRNA gene sequence |
GGGCCTTTAGCTCAGTTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTGCCTGGTTCAAC |
Downstream region at tRNA end position |
ttttggggat |
Secondary structure (Cloverleaf model) | >WENV180098424 Ile GAT t ACCA ttttggggat G - C G - C G - C C - G C - G T - A T - A T C T G G A C C A T G A A | | | | | A T C T C G C C T G G C G | | | | T T G G A G C T T A G AGGTG C - G A - T C - G G - C C - G C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |