Sequence ID | >WENV180098561 |
Genome ID | MTBK01254050 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 8465 |
End posion on genome | 8379 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gccagcttgT |
tRNA gene sequence |
GCCGAGGTAGTCTAGTCCGGGAAGGCGGTGGCCTCGAAAGCCACTGGTGTTCAACACCTC |
Downstream region at tRNA end position |
taggataaaa |
Secondary structure (Cloverleaf model) | >WENV180098561 Ser CGA T GTtt taggataaaa G - C C - G C - G G - C A - T G - C G - C T A T C C C T C A T G A A | | | | | A C T C T G G G G A G C C | | + | T T G A G G C G G A G TGGTGTTCAACACCTC G - C T - A G - C G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |