Sequence ID | >WENV180098611 |
Genome ID | MTBK01257280 |
Search identical group | |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 4753 |
End posion on genome | 4824 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
aacacggctt |
tRNA gene sequence |
GCCAAGGTGGCGGAGCGGCCACGCGGTTGACTGCAGATCAACTACACCCCGGTTCAAATC |
Downstream region at tRNA end position |
atccggtttc |
Secondary structure (Cloverleaf model) | >WENV180098611 Cys GCA t Ttcc atccggtttc G - C C - G C - G A - T A - T G - C G - C T A T G G G C C A G A G | | | | | A C G G C G C C C G G C G | | | T T G A C G C C C G TACAC G - C T - A T - A G - C A - T C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |