Sequence ID | >WENV180098970 |
Genome ID | MTBK01278976 |
Phylum/Class | [MTBK] anaerobic digester metagenome; biogas reactors fed with pig manure or primary and secondary sludge |
Species | |
Start position on genome | 19943 |
End posion on genome | 20019 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
ccagggatga |
tRNA gene sequence |
CGCGGGGTGGAGCAGTCAGGTAGCTCGTCGGGCTCATAACCCGGAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
tttttattag |
Secondary structure (Cloverleaf model) | >WENV180098970 fMet CAT a ACCA tttttattag C A G - C C - G G - C G - C G - C G - C T A T C G T C C A T G A G | | | | | A C C G A G G C A G G C A | | | | T T G G C T C G T A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |