Sequence ID | >WENV180099319 |
Genome ID | NKAJ01001664 |
Search identical group | |
Phylum/Class | [NKAJ] marine sediment metagenome; Jiulong cold seep at northern South China Sea |
Species | |
Start position on genome | 702 |
End posion on genome | 627 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
tggattacaa |
tRNA gene sequence |
GCGGGTGTAGCTCAGTTGGTAGAGTACAAGCTTCCCAAGCTTGGGGTCGCGGGTTCAAAC |
Downstream region at tRNA end position |
accctttttg |
Secondary structure (Cloverleaf model) | >WENV180099319 Gly CCC a TCCA accctttttg G - C C - G G - C G - C G - C T + G G - C C A T T G C C C A T G A A + | | | | A T C T C G G C G G G C G | | | + T T G G A G T T A A GGGTC C - G A - T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |