Sequence ID | >WENV180099549 |
Genome ID | NMRC01016342 |
Search identical group | |
Phylum/Class | [NMRC] plant metagenome; fluid collected inside the plant's pitcher |
Species | |
Start position on genome | 285 |
End posion on genome | 211 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
caaccccaat |
tRNA gene sequence |
CGGGATGTAGCGTAGCCCGGTATCGCGCCACATTTGGGATGTGGAGGCCGCAGGTTCGAA |
Downstream region at tRNA end position |
agacgaaaat |
Secondary structure (Cloverleaf model) | >WENV180099549 Pro TGG t ACta agacgaaaat C - G G - C G - C G - C A - T T - A G - C T A T C G T C C A C G A A | | | | | G C T G C G G C A G G C C | | | T T G T C G C G T A G AGGCC C - G C - G A - T C - G A - T T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |