| Sequence ID | >WENV180099692 |
| Genome ID | NMRC01022807 |
| Phylum/Class | [NMRC] plant metagenome; fluid collected inside the plant's pitcher |
| Species | |
| Start position on genome | 106 |
| End posion on genome | 31 |
| Amino Acid | Val |
| Anticodon | TAC |
| Upstream region at tRNA start position |
agcgggtttg |
| tRNA gene sequence |
GGGCCTTTAGCTCAGTTGGTAGAGCGCCACGTTTACACCGTGGATGTCATCGGTTCGAGC |
| Downstream region at tRNA end position |
ttatgatgag |
| Secondary structure (Cloverleaf model) | >WENV180099692 Val TAC
g ACCA ttatgatgag
G - C
G - C
G - C
C - G
C - G
T + G
T - A C G
T T G G C C A
T G A A | + | | | G
T C T C G A T C G G C
G | | | | T T
G G A G C
T A G ATGTC
C - G
C - G
A - T
C - G
G - C
T C
T A
T A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |