Sequence ID | >WENV180100086 |
Genome ID | OANK01021976 |
Search identical group | |
Phylum/Class | [OANK] marine metagenome; ENVO:00002010 |
Species | |
Start position on genome | 131 |
End posion on genome | 55 |
Amino Acid | fMet |
Anticodon | CAT |
Upstream region at tRNA start position |
tcttaggaca |
tRNA gene sequence |
TGCGGGGTAGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGTTGGTTCAAA |
Downstream region at tRNA end position |
atttaaagcc |
Secondary structure (Cloverleaf model) | >WENV180100086 fMet CAT a ACCA atttaaagcc T T G - C C - G G - C G - C G - C G - C T A T C A A C C A C G A A | | | | | A C C G A G G T T G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |