Sequence ID | >W141008237 |
Genome ID | AGZM01000013 |
Search identical group | |
Phylum/Class | Bacteroidota |
Species | Parabacteroides distasonis CL03T12C09 [AGZM] |
Start position on genome | 61394 |
End posion on genome | 61468 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tacaaaaaaa |
tRNA gene sequence |
CGGGATGTAGCACAGTTGGCTAGCGCGCCACGTTCGGGACGTGGAGGTCGGAAGTTCGAG |
Downstream region at tRNA end position |
atcaaaaagg |
Secondary structure (Cloverleaf model) | >W141008237 Pro CGG a ACtc atcaaaaagg C - G G - C G - C G - C A - T T - A G - C T G T T C T T C A T G A A + | | | | G T C A C G G G A A G C G | | | T T G G C G C C T A G AGGTC C - G C - G A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |