Sequence ID | >WENV180102761 |
Genome ID | OAOZ01011292 |
Search identical group | |
Phylum/Class | [OAOZ] marine metagenome; ENVO:00002010 |
Species | |
Start position on genome | 252 |
End posion on genome | 165 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
actcttctgc |
tRNA gene sequence |
GGAGGCCTGTCCGAGCGGCCGATGGAGCTGGTCTTGAAAACCAGTGGGCAGAAATGTCTC |
Downstream region at tRNA end position |
ttttgattca |
Secondary structure (Cloverleaf model) | >WENV180102761 Ser TGA c GCCA ttttgattca G - C G - C A - T G - C G - C C - G C - G T A T C A C C C A C G A G | | | | | G G G C C T G T G G G C G + | | | T T C T G G A C G A G TGGGCAGAAATGTCTC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |