Sequence ID | >WENV180106078 |
Genome ID | OAPE01017560 |
Search identical group | |
Phylum/Class | [OAPE] marine metagenome; Sterivex cartridges |
Species | |
Start position on genome | 180 |
End posion on genome | 250 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gcgtactagc |
tRNA gene sequence |
GCGGGCGTAGTTTAGTGGTAAAACCTCAGCCTTCCAAGCTGATGATGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ttttgattct |
Secondary structure (Cloverleaf model) | >WENV180106078 Gly TCC c Ttaa ttttgattct G - C C - G G - C G - C G - C C - G G - C T T T C G C C C A G A A | | | | | G T T T T G G C G G G C G | | | | T T G A A A C T A C TGAT T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |