Sequence ID | >WENV180106762 |
Genome ID | OAPF01002343 |
Search identical group | |
Phylum/Class | [OAPF] marine metagenome; ENVO:00002010 |
Species | |
Start position on genome | 411 |
End posion on genome | 336 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cccgctcagt |
tRNA gene sequence |
GCCCCTATAGCTCAGCTGGTAGAGCAACTGATTTGTAATCAGTGGGTCGGGAGTTCGAGT |
Downstream region at tRNA end position |
tccagttcca |
Secondary structure (Cloverleaf model) | >WENV180106762 Thr TGT t ACCA tccagttcca G - C C - G C - G C - G C - G T + G A - T T G T C T C T C A C G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C T A A GGGTC A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |