| Sequence ID | >WENV180115941 |
| Genome ID | OAPT01073372 |
| Phylum/Class | [OAPT] marine metagenome; seawater |
| Species | |
| Start position on genome | 244 |
| End posion on genome | 168 |
| Amino Acid | fMet |
| Anticodon | CAT |
| Upstream region at tRNA start position |
atttggctgc |
| tRNA gene sequence |
CGCGGGGTAGTGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGGGAGTTCAAA |
| Downstream region at tRNA end position |
catctgattg |
| Secondary structure (Cloverleaf model) | >WENV180115941 fMet CAT
c ACCA catctgattg
C C
G - C
C - G
G - C
G - C
G - C
G - C T A
T C C C T C A
T G A A | | | | | A
C C G T G G G G A G C
T | | | T T
G G C T C
G T A G AGGTC
T - A
C - G
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |