| Sequence ID | >WENV180129522 |
| Genome ID | OATD01000010 |
| Phylum/Class | [OATD] human gut metagenome; faeces |
| Species | |
| Start position on genome | 56806 |
| End posion on genome | 56734 |
| Amino Acid | Thr |
| Anticodon | GGT |
| Upstream region at tRNA start position |
ctcttttttc |
| tRNA gene sequence |
GCTGTTATAGCTCAGTGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCCCGGGTTCAAATC |
| Downstream region at tRNA end position |
taagatgtaa |
| Secondary structure (Cloverleaf model) | >WENV180129522 Thr GGT
c TCtg taagatgtaa
G - C
C - G
T - A
G - C
T - A
T - A
A - T T A
T G G C C C A
G A A | | | | | A
T C T C G C C G G G C
G | | | | T T
G G A G C
T A A AGGTC
C - G
T - A
T - A
C - G
C - G
T A
T A
G G T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |