Sequence ID | >WENV180131709 |
Genome ID | OATH01000037 |
Search identical group | |
Phylum/Class | [OATH] human gut metagenome; faeces |
Species | |
Start position on genome | 123584 |
End posion on genome | 123511 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cggaacatat |
tRNA gene sequence |
TCCTGCGTAGCTCAGTTGGCAGAGCATTCGACTGTTAATCGAACGGTCACTGGTTCAAGC |
Downstream region at tRNA end position |
tttagccctt |
Secondary structure (Cloverleaf model) | >WENV180131709 Asn GTT t GCtt tttagccctt T - A C - G C - G T - A G - C C - G G - C C G T T G A C C A T G A A | | | | | A T C T C G A C T G G C G | | | | T T G G A G C C A A CGGTC T - A T - A C - G G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |