| Sequence ID | >WENV180131815 |
| Genome ID | OATH01000136 |
| Phylum/Class | [OATH] human gut metagenome; faeces |
| Species | |
| Start position on genome | 15390 |
| End posion on genome | 15464 |
| Amino Acid | Gln |
| Anticodon | CTG |
| Upstream region at tRNA start position |
cctgccaaat |
| tRNA gene sequence |
TGGGATGTGGTGTAATTGGCAACACAGCTGATTCTGGTTCAGCCATTCTTGGTTCGAGTC |
| Downstream region at tRNA end position |
atgagccctc |
| Secondary structure (Cloverleaf model) | >WENV180131815 Gln CTG
t GCCA atgagccctc
T - A
G - C
G - C
G - C
A - T
T - A
G - C T G
T G G A C C A
T A A G | + | | | G
T T G T G C T T G G C
G | | | | T T
G A C A C
C A A CATT
G - C
C - G
T - A
G - C
A - T
T T
T G
C T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |