Sequence ID | >WENV180136005 |
Genome ID | OATL01001318 |
Search identical group | |
Phylum/Class | [OATL] human gut metagenome; faeces |
Species | |
Start position on genome | 168 |
End posion on genome | 252 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
ttcctaaaat |
tRNA gene sequence |
GCGCAGGTGGTGGAATTGGTAGACACGCTACTTTGAGGGGGTAGTGCCGGTTACGGCGTG |
Downstream region at tRNA end position |
aagtaaaaaa |
Secondary structure (Cloverleaf model) | >WENV180136005 Leu GAG t ACtt aagtaaaaaa G + T C - G G - C C - G A - T G - C G - C T G T T A C T C A T A A G + | | | | A T G G T G G T G A G C G | | | T T G A C A C T A G G TGCCGGTTACGGCGT C - G T - A A - T C - G T + G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |