Sequence ID | >WENV180137624 |
Genome ID | OATP01000094 |
Search identical group | |
Phylum/Class | [OATP] human gut metagenome; faeces |
Species | |
Start position on genome | 58288 |
End posion on genome | 58361 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttaggtactT |
tRNA gene sequence |
GCGCGGTTAGTGTAATGGATCGCACGTGAGATTCCGGTTCTCGAAATCCGGGTTCGACTC |
Downstream region at tRNA end position |
acccagtcaa |
Secondary structure (Cloverleaf model) | >WENV180137624 Arg CCG T AGaa acccagtcaa G - C C - G G - C C - G G + T G - C T + G T C T G G C C C A T A A A | | | | | G G T G T G C C G G G C G + | | | T T A G C A C T C G AAAT T + G G - C A - T G - C A - T T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |