Sequence ID | >WENV180137824 |
Genome ID | OATP01000751 |
Search identical group | |
Phylum/Class | [OATP] human gut metagenome; faeces |
Species | |
Start position on genome | 15060 |
End posion on genome | 15134 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tgagaaatat |
tRNA gene sequence |
TCCTTAGTAGCTCAGTTGGTTAGAGCGGCGGACTGTTAATCCGTAGGTCGTAGGTTCAAG |
Downstream region at tRNA end position |
aaagccacta |
Secondary structure (Cloverleaf model) | >WENV180137824 Asn GTT t GCaa aaagccacta T - A C - G C - G T - A T + G A - T G - C T G T C A T C C A T G A A | | | | | A T C T C G G T A G G C G | | | | T T G G A G C T T A G AGGTC G + T C - G G - C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |