Sequence ID | >WENV180139794 |
Genome ID | OATT01000914 |
Search identical group | |
Phylum/Class | [OATT] human gut metagenome; faeces |
Species | |
Start position on genome | 7403 |
End posion on genome | 7332 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tttttctaaa |
tRNA gene sequence |
GGCCTGATGGTCAAGCGGTCAAGACGACGCCCTCTCACGGCGTAAACCCGGGTTCGATTC |
Downstream region at tRNA end position |
atgagatggc |
Secondary structure (Cloverleaf model) | >WENV180139794 Glu CTC a Attg atgagatggc G - C G + T C - G C - G T - A G - C A - T T T T G G C C C A C G A G | | | | | G G A C T G C C G G G C G | | | T T T A G A C C A G AAAC A - T C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |