Sequence ID | >WENV180140313 |
Genome ID | OATT01051583 |
Search identical group | |
Phylum/Class | [OATT] human gut metagenome; faeces |
Species | |
Start position on genome | 8 |
End posion on genome | 81 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
nnnataatat |
tRNA gene sequence |
GCGGGTATCGTATATCGGTAATACTCCAGCCTTCCAAGCTGGCAAGGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tacaaacgat |
Secondary structure (Cloverleaf model) | >WENV180140313 Gly TCC t TCCA tacaaacgat G - C C - G G - C G - C G - C T - A A - T T T T C A C C C A T A C | | | | | G C T A T G G T G G G C G | | | | T T G A T A C T A T CAAG C - G C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |