Sequence ID | >W141012697 |
Genome ID | AHUW01000018 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Salmonella enterica subsp. enterica serovar Javiana str. ATCC BAA-1593 [AHUW] |
Start position on genome | 56284 |
End posion on genome | 56208 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
acggcgctaa |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGCGCTGCCCTCCGGAGGCAGAGGTCTCAGGTTCGAA |
Downstream region at tRNA end position |
tttatttagg |
Secondary structure (Cloverleaf model) | >W141012697 Arg CCG a ACCA tttatttagg G + T C - G G - C C - G C - G C - G G - C T A T T G T C C A C G A A | | | | G T C T C G T C A G G C G | | | | T T G G A G C A T A G AGGTC C - G T - A G - C C - G C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |