Sequence ID | >w006967 |
Genome ID | AAIC01000035 |
Search identical group | |
Phylum/Class | Chlorobiota |
Species | Chlorobium phaeobacteroides BS1 [AAIC] |
Start position on genome | 157 |
End posion on genome | 85 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tccagtaaag |
tRNA gene sequence |
CGGGGCATGGCGCAGCTGGTAGCGTGCCTGCTTTGGGAGCAGGAGGTCCCGAGTTCGAGT |
Downstream region at tRNA end position |
gaaggagtgt |
Secondary structure (Cloverleaf model) | >w006967 Pro TGG g Acaa gaaggagtgt C - G G - C G - C G - C G - C C - G A - T T G T G G C T C A C G A G | | | | | G T C G C G C C G A G C G | | | + T T G G C G T T A G AGGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |