Sequence ID | >WENV180161809 |
Genome ID | OAVF01000068 |
Search identical group | |
Phylum/Class | [OAVF] human gut metagenome; faeces |
Species | |
Start position on genome | 35750 |
End posion on genome | 35677 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
tcacaggctc |
tRNA gene sequence |
GGGCGATTGGCGCAGCGGCTAGCGCACTTCGTTCACACCGAAGGGGTCGTAGGTTCGATT |
Downstream region at tRNA end position |
gattccgctt |
Secondary structure (Cloverleaf model) | >WENV180161809 Val CAC c ACtg gattccgctt G - C G - C G - C C - G G - C A - T T - A T T T C A T C C A C G A G | | | | | G G C G C G G T A G G C G | | | | T T C G C G C T A A GGGTC C - G T - A T - A C - G G - C T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |