Sequence ID | >WENV180162691 |
Genome ID | OAVH01000042 |
Search identical group | |
Phylum/Class | [OAVH] human gut metagenome; faeces |
Species | |
Start position on genome | 20430 |
End posion on genome | 20506 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gcaagtcaaa |
tRNA gene sequence |
GCGCCCGTAGCTCAATTGGATAGAGCGTCTGACTACGGATCAGAAGGTTTGGGGTTCGAA |
Downstream region at tRNA end position |
cttgcatcac |
Secondary structure (Cloverleaf model) | >WENV180162691 Arg ACG a GCCA cttgcatcac G + T C - G G - C C - G C - G C - G G - C T A T A T C C C A T A A A | + | | | G T C T C G T G G G G C G | | | | T T G G A G C A T A G AGGTT T - A C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |