Sequence ID | >WENV180172221 |
Genome ID | OAVX01000473 |
Search identical group | |
Phylum/Class | [OAVX] human gut metagenome; faeces |
Species | |
Start position on genome | 16156 |
End posion on genome | 16227 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
tgttaaatat |
tRNA gene sequence |
TGTTCTATGGTGTAATGGTAGCACAACAGATTCTGGTCCTGTTTGTCCTGGTTCGAATCC |
Downstream region at tRNA end position |
ttaaagttta |
Secondary structure (Cloverleaf model) | >WENV180172221 Gln CTG t ACgt ttaaagttta T - A G - C T - A T - A C - G T - A A - T T A T G G A C C A A A G | | | | | G T T G T G C C T G G C G + | | | T T G G C A C T A A TTGT A - T C - G A - T G - C A C T T T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |