Sequence ID | >WENV180174926 |
Genome ID | OAWB01000861 |
Search identical group | |
Phylum/Class | [OAWB] human gut metagenome; faeces |
Species | |
Start position on genome | 3056 |
End posion on genome | 3129 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aaagtgtcac |
tRNA gene sequence |
GCCGCTATAGCTCAGTCGGTAGAGCAACGCATTCGTAACGCGTAGGTCGCCAGTTCAAGT |
Downstream region at tRNA end position |
ttataagaga |
Secondary structure (Cloverleaf model) | >WENV180174926 Thr CGT c TCtt ttataagaga G - C C - G C - G G - C C - G T - A A - T T G T C G G T C A T G A A | | | | | A C C T C G G C C A G C G | | | | T T G G A G C T A A AGGTC A - T C - G G - C C - G A C T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |