Sequence ID | >WENV180176878 |
Genome ID | OAWD01002749 |
Search identical group | |
Phylum/Class | [OAWD] human gut metagenome; faeces |
Species | |
Start position on genome | 1528 |
End posion on genome | 1604 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
tatgtactgc |
tRNA gene sequence |
GGCCTGGTAGTTCAGTTGGTTAGAATGCCAGCCTGTCACGCTGGAGGTCGAGAGTTCGAG |
Downstream region at tRNA end position |
tttttattgt |
Secondary structure (Cloverleaf model) | >WENV180176878 Asp GTC c GCCA tttttattgt G - C G + T C - G C - G T - A G - C G - C T G T T T C T C A T G A A + | | | | G T C T T G G A G A G C G | | | + T T G G A A T T T A G AGGTC C - G C - G A - T G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |