Sequence ID | >WENV180179663 |
Genome ID | OAWJ01004413 |
Search identical group | |
Phylum/Class | [OAWJ] human gut metagenome; faeces |
Species | |
Start position on genome | 3104 |
End posion on genome | 3028 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
acaaaagctt |
tRNA gene sequence |
CGGGACGTGGCGCAGCTTGGTAGCGCACTTGACTGGGGGTCAAGGGGTCGCTGGTTCGAA |
Downstream region at tRNA end position |
gaagtttgca |
Secondary structure (Cloverleaf model) | >WENV180179663 Pro GGG t ACCA gaagtttgca C - G G - C G - C G - C A - T C - G G - C T A T T G A C C A C G A G + | | | | G T C G C G G C T G G C T | | | | T T G G C G C G T A A GGGTC C - G T - A T - A G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |