Sequence ID | >WENV180185682 |
Genome ID | OAWU01000040 |
Search identical group | |
Phylum/Class | [OAWU] human gut metagenome; faeces |
Species | |
Start position on genome | 967 |
End posion on genome | 1041 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aatggcgcat |
tRNA gene sequence |
CGGGCTATAGCGCAGTTTGGTAGCGCGCCTGCTTTGGGAGCAGGATGTCGCCGGTTCAAA |
Downstream region at tRNA end position |
acaaaaaagc |
Secondary structure (Cloverleaf model) | >WENV180185682 Pro TGG t ACaa acaaaaaagc C - G G - C G - C G - C C - G T - A A - T T A T C G G C C A T G A A | | | | | A T C G C G G C C G G C T | | | | T T G G C G C G T A G ATGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |