Sequence ID | >WENV180188405 |
Genome ID | OAWX01000007 |
Search identical group | |
Phylum/Class | [OAWX] human gut metagenome; faeces |
Species | |
Start position on genome | 89189 |
End posion on genome | 89103 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
taacaatcag |
tRNA gene sequence |
GCCGGCGTGGCGGAATTGGCAGACGCACAGGACTTAAAATCCTGCGGGACTTATACTCCC |
Downstream region at tRNA end position |
aaattttgga |
Secondary structure (Cloverleaf model) | >WENV180188405 Leu TAA g Atat aaattttgga G - C C - G C - G G - C G - C C - G G - C C C T T G G C C A T A A G | | | | | G T G G C G A C C G G C G | | | T T G A C G C C A G A CGGGACTTATACTCCCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |