Sequence ID | >WENV180189066 |
Genome ID | OAWX01004710 |
Search identical group | |
Phylum/Class | [OAWX] human gut metagenome; faeces |
Species | |
Start position on genome | 2425 |
End posion on genome | 2353 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cgagttgttc |
tRNA gene sequence |
GCCCCCATCGTCTAACGGTTAGGACACCAGACTTTCAATCTGACAACGAGAGTTCGACTC |
Downstream region at tRNA end position |
cactaaagac |
Secondary structure (Cloverleaf model) | >WENV180189066 Glu TTC c ACtt cactaaagac G + T C - G C - G C - G C - G C - G A - T T C T C T C T C A C A A C | | | | | G G T C T G G A G A G C G + | | | T T T G G A C T A A CAAC C A C - G A - T G - C A - T C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |