Sequence ID | >WENV180191252 |
Genome ID | OAXB01010857 |
Search identical group | |
Phylum/Class | [OAXB] human gut metagenome; faeces |
Species | |
Start position on genome | 707 |
End posion on genome | 632 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
caccattatg |
tRNA gene sequence |
GTGAATGTAGTTCAGTTGGTAGAGCGCCAGTTTGTGGCACTGGTTGTCGTGGGTTCGAGT |
Downstream region at tRNA end position |
tgttgggatg |
Secondary structure (Cloverleaf model) | >WENV180191252 His GTG g CCCA tgttgggatg G - C T - A G - C A - T A - T T + G G - C T G T T A C C C A T G A A + | | | | G T C T T G G T G G G C G | | + | T T G G A G C T A G TTGTC C - G C - G A - T G - C T - A T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |