Sequence ID | >WENV180192709 |
Genome ID | OAXJ01055543 |
Search identical group | |
Phylum/Class | [OAXJ] human gut metagenome; faeces |
Species | |
Start position on genome | 92 |
End posion on genome | 9 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
gttatgtttc |
tRNA gene sequence |
GCCGAAGTGGCGGAATAGGCAGACGCGCCAGACTCAAAATCTGGTTCCTTCACGGGAGTG |
Downstream region at tRNA end position |
cctaannnnn |
Secondary structure (Cloverleaf model) | >WENV180192709 Leu CAA c Ataa cctaannnnn G - C C - G C - G G - C A - T A - T G - C C C T C G G C C A T A A G | | | | | G A G G C G G C C G G C G | | | T T G A C G C C A G G TTCCTTCACGGGAGT C - G C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |