Sequence ID | >WENV180194849 |
Genome ID | OAZY01000200 |
Search identical group | |
Phylum/Class | [OAZY] human gut metagenome; faeces |
Species | |
Start position on genome | 773 |
End posion on genome | 847 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
agccaatatt |
tRNA gene sequence |
GGCCCGTTGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTATCCCGGGTTCGATTC |
Downstream region at tRNA end position |
catggacgat |
Secondary structure (Cloverleaf model) | >WENV180194849 Glu TTC t ACCA catggacgat G - C G + T C - G C - G C - G G - C T - A T T T G G C C C A C G A G | | | | | G G A C T G C C G G G C G | | | T T T A G A C T A A TATC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |