Sequence ID | >WENV180206893 |
Genome ID | OBAI01001527 |
Search identical group | |
Phylum/Class | [OBAI] human gut metagenome; human gut |
Species | |
Start position on genome | 13826 |
End posion on genome | 13751 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
cggctgtcat |
tRNA gene sequence |
GTTCCCTTCTTCTAGCGGTCAGGAAGGCCGTCTCTCCAACGGCAAAGGCTCGGTTCAACT |
Downstream region at tRNA end position |
tccggcagcc |
Secondary structure (Cloverleaf model) | >WENV180206893 Glu CTC t GCCA tccggcagcc G + T T - A T - A C - G C - G C - G T - A T C T C G G C C A C G A C + | | | A G T C T T C T C G G C G + | | | T T T G G A A C A G AAAGG G - C C - G C - G G - C T - A C A T C C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |